Core.Cast-Transform-Convert 3.1.0

There is a newer version of this package available.
See the version list below for details. 
dotnet add package Core.Cast-Transform-Convert --version 3.1.0
NuGet\Install-Package Core.Cast-Transform-Convert -Version 3.1.0
This command is intended to be used within the Package Manager Console in Visual Studio, as it uses the NuGet module's version of Install-Package. 
<PackageReference Include="Core.Cast-Transform-Convert" Version="3.1.0" />
For projects that support PackageReference, copy this XML node into the project file to reference the package. 
paket add Core.Cast-Transform-Convert --version 3.1.0
#r "nuget: Core.Cast-Transform-Convert, 3.1.0"
#r directive can be used in F# Interactive and Polyglot Notebooks. Copy this into the interactive tool or source code of the script to reference the package. 
// Install Core.Cast-Transform-Convert as a Cake Addin
#addin nuget:?package=Core.Cast-Transform-Convert&version=3.1.0

// Install Core.Cast-Transform-Convert as a Cake Tool
#tool nuget:?package=Core.Cast-Transform-Convert&version=3.1.0

An easy-to-use, portable, tested, documented, serializable, thread-safe, strongly typed library for changing between unrestricted, arbitrary data types

There are no supported framework assets in this package.

Learn more about Target Frameworks and .NET Standard.

NuGet packages

This package is not used by any NuGet packages.

GitHub repositories

This package is not used by any popular GitHub repositories.

Version Downloads Last updated
3.2.0.94 2,143 11/1/2016
3.2.0.93 1,674 11/1/2016
3.2.0.92 1,685 11/1/2016
3.2.0.91 1,727 11/1/2016
3.2.0.89 1,402 10/19/2016
3.2.0.86 1,452 10/17/2016
3.2.0.84 1,479 10/17/2016
3.2.0.82 1,476 10/17/2016
3.2.0.81 1,446 10/14/2016
3.2.0.80 1,434 10/14/2016
3.2.0.79 1,450 10/14/2016
3.2.0.78 1,490 10/13/2016
3.2.0.77 1,422 10/13/2016
3.2.0 1,412 10/13/2016
3.1.0.69 1,412 10/9/2016
3.1.0.5 1,559 10/9/2016
3.1.0.2 2,228 9/21/2016
3.1.0 1,442 10/3/2016
3.0.1.4 1,507 9/13/2016
3.0.1 1,424 10/3/2016

=== Key Features ===

-Central thread-safe pool of converting functions
-Data Encapsulation
-Add converters at runtime or compile-time
-Consistent exception behavior
-Optional functions following the "Try" convention of .NET
-Instant improvement of source-code readability and maintainability
-Low overall performance impact
-Little to no learning curve
-Independent, portable library

______________________________________________________

### Getting started in 4 steps

1. *Install* with the <a href="http://goo.gl/iekUWH" target="_blank">NuGet Package manager</a>: `PM> Install-Package Core.TypeCast`.  
2. *Add the namespace* to your top-listed using directives: `using Core.TypeCast;`.
3. *Create a class* with one or more methods: `class MyConverter { ... int MyConverter(string argument) ... }`
4. *Attribute* any class with `[ConverterAttribute]`: _`public class MyConverter { ... }`_.    
   Subsequently, attribute the converting methods using `[ConverterMethodAttribute]`: _`public int MyConverter(string attribute){ ... }`__
5. **Done!**

Now, invoke conversions in your code anywhere as follows:
```cs
   var castedInt = "500s".CastTo<int>();
   var protein = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".ConvertTo<IProtein>();
```
Use library functions which suit the change of type descriptively:

   `var complimentary = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".Transform<Complementary>();`


_____________________________________________________

### Code Glance

Provided below is an abbreviated example of what code may look like in your project:

```cs
   using System.Runtime.CompilerServices;
   // IPolyNucleotide.cs
   public interface IPolyNucleotide { ... }

   // used for "Tranform-Aliasing"
   delegate DNA Complimentary(string dnaSequence, AModelClass arguments);

   // DNA.cs
   [Converter]
   public class DNA : IPolyNucleotide
   {
       [ConverterMethod]
       protected IProtein ToProtein(string dnaSequence, bool homologyLookup = false)
       {
           ... ...
       }

       [ConverterMethod]
       [MethodImpl(MethodImplOptions.AggressiveInlining)]
       public static DNA Complimentary(string dnaSequence, AModelClass arguments)
       {
           ... ...
       }
       ...
   }
```